منابع پایان نامه درباره
گروه کنترل

منابع پایان نامه درباره گروه کنترل

دی ۸, ۱۳۹۷ 0 By mitra1--javid

شد.
سپس پلاسمای غنی از پلاکت جمع‌آوری‌شده در g×۵۰۰۰ و دمای اتاق به مدت ۱۵ دقیقه سانتریفیوژ شد. مایع رویی پلاسمای کم پلاکت نام دارد که این پلاسمای کم پلاکت۴۴ به داخل کیسه انتقالی دیگر منتقل‌شده و همچنین مقداری از PPP برای آزمایش‌های ویروسی- مایکوپلاسما- باکتریایی و اندوتوکسین استفاده شد. تنها ۵۰ یا ۱۰۰ میلی‌لیتر پلاسما بر روی کنسانتره پلاکتی باقی می‌ماند که روی shaker به حالت سوسپانسیون درآمده و توسط دستگاه شمارشگر سلولی پلاکت‌ها شمارش شدند. اگر مقدار پلاکت در کنسانتره پلاکتی ml/۱۰۹×۱ باشد برای تهیه عصاره پلاکتی مناسب است.
کنسانتره پلاکتی یک شبانه‌روز در فریزر C°۷۰- نگهداری شد و تا کسب اطمینان از نتایج منفی آزمایش‌های غربالگری، قرنطینه گردید. سپس کنسانتره پلاکتی در بن ماری C°۳۷ به‌صورت کامل ذوب شد. به‌منظور حذف بقایای پلاکتی، کنسانتره ذوب‌شده در g۳۰۰۰ به مدت ۳۰ دقیقه و در دمای اتاق سانتریفیوژ شد. محلول رویی پس از سانتریفیوژ عصاره پلاکتی نامیده می‌شود. عصاره پلاکتی به‌دست‌آمده در این مرحله در حجم مورد نظر (۱۰-۵ میلی‌لیتر) تقسیم‌بندی شد و در فریزر °۷۰- سانتی‌گراد تا زمان استفاده ذخیره گردید.

۲-۳ بررسی اثر عصاره پلاکتی بر تکثیر (فیبروبلاست)
در این مطالعه سلول‌ها به تعداد ۵۰۰۰۰ سلول در هر خانه از پلیت ۶ خانه ریخته شد و کشت داده شد.
سلول‌های فیبروبلاست در محیط کشت DMEM حاوی غلظت‌های ۵%،۸%،۱۰%،۱۵% و ۲۰% از عصاره پلاکتی مشتق از خون‌بند ناف همراه با گروه کنترل مثبت که حاوی FBS 10% و کنترل منفی که خالی از هر ۲ (FBS وUCB-PL) بود، کشت شدند و همچنین از گروه (UCB-PL/FBS) که به نسبت مساوی از عصاره پلاکتی مشتق از خون‌بند ناف و FBS استفاده شد. در محیط کشت‌هایی که از فرآورده UCB-PL استفاده شد به ازای هر ۱ میلی‌لیتر محیط کشت ۱ میکرو لیتر هپارین اضافه گردید تا از بستن یا ژله‌ای‌ای شدن محیط جلوگیری شود. بعد از گذشت ۲۴، ۴۸ و ۷۲ ساعت با ماده تریپان بلو رنگ‌آمیزی شدند و با استفاده از میکروسکوپ اینورت سلول‌ها شمرده شدند و تفاوت تکثیر در ساعات مختلف در غلظت‌های مختلف محاسبه گردید.

شکل ۲- ۱: کشت سلول در پلیت ۶ خانه

۲-۴ بررسی اثر فرآورده عصاره پلاکتی بر درصد بقاء سلول‌های فیبروبلاست
در این مرحله نیز مقدار سلول‌ها و نوع پلیت مصرفی و غلظت محیط کشت‌ها همانند مرحله اندازه‌گیری تکثیر سلولی انجام شد با این تفاوت که در این مرحله بعد از ۲۴ ساعت سلول‌ها با تریپان بلو رنگ‌آمیزی شد و تعداد سلول‌های زنده در غلظت‌های مختلف فرآورده عصاره پلاکتی سنجیده شد.

۲-۵ اندازه‌گیری میزان مهاجرت سلولی به روش assay Scratch
به‌منظور سنجش اثر UCB-PL بر میزان مهاجرت سلولی از تست Scratching استفاده شد. برای اجرای این تست از پلیت های ۶ خانه استفاده شد و در هر خانه ۱×۱۰۵ سلول با ۴ میلی‌لیتر محیط DMEM حاوی FBS 10% ریخته شد. پس از ۳ روز کف پلیت با سلول‌ها پوشیده شد و محیط آن‌ها با همان محیط قبلی تعویض شد. بعد از ۲۴ ساعت با استفاده از نوک تیپ کریستالی و خط‌کش در وسط هر خانه به‌صورت قطری خراش ایجاد شد. سپس محیط هر خانه تخلیه و ۳ بار با PBS جهت زدودن بقایای سلولی ایجاد شده شست‌وشو داده شد و این بار برای هر خانه ۴ میلی‌لیتر محیط DMEM حاوی غلظت‌های متفاوت از فرآورده لایزت پلاکتی مشتق از خون‌بند ناف ۸%-۱۰% و گروه UCB-PL/FBS (به نسبت مساوی از هرکدام) و همچنین محیط بدون لایزت پلاکتی (کنترل مثبت حاوی FBS 10% و کنترل منفی بدون (FBS و UCB-PL)) ریخته شد. سپس از هر نمونه در محل خراش در لحظهی ۰، ۶، ۱۲ و ۲۴ ساعت بعد از خراش توسط دوربین متصل به میکروسکوپ عکس‌برداری شد.
میزان مهاجرت سلولی به درون فضای خراش در ساعت‌های مذکور با نرم‌افزار Cell sience محاسبه شد. به این صورت که فاصله بین دو لبه خراش توسط چندین خط توسط نرم‌افزار اندازه‌گیری شده سپس میانگین خطوط اندازه‌گیری شده محاسبه گردید و آن را در فرمول بسته شدن زخم قرار داده شد و میزان بسته شدن هر خراش را به‌صورت کمی محاسبه شد.

۲-۶ فرمول بکار رفته در تست خراشیدگی

شکل ۲- ۲: نحوه کشیدن خراش در تکنیک assay Scratch
۲-۷ بررسی بیان ژن
برای بررسی بیان ژن‌های موردنظر مراحل زیر به ترتیب انجام می‌شود:
استخراج RNA
سنتز cDNA
طراحی پرایمر و انجام PCR
در این مرحله نیز فیبروبلاستها در محیط کشت حاوی غلظت‌های متفاوت از فرآورده لایزت پلاکتی مشتق از خون‌بند ناف ۸% -۱۰% و گروه UCB-PL/FBS (به نسبت مساوی از هرکدام) و همچنین محیط بدون عصاره پلاکتی (کنترل مثبت حاوی FBS 10% و کنترل منفی بدون (FBS و UCB-PL)( در فلاسکهای ۲۵ کشت داده شدند. بعدازاینکه سلول‌ها کاملاً کف فلاسک را پر کردند آن‌ها را جمع کرده و برای مرحله استخراج RNA رسوب سلول‌ها استفاده شد.

۲-۷-۱ مراحل استخراج RNA
استخراج RNA با استفاده از ترایزول انجام شد
۱. ۱ میلی‌لیتر ترایزول به ازای هر ۱۰۰۰۰۰۰ سلول به‌منظور لیز سلول‌هایی که توسط بافر فسفات سالین فاقد یون شسته شده‌اند، اضافه شد. در این مرحله نمونه به‌خوبی پیپتاژ گردید تا از لیز شدن سلول‌ها و خروج ماده ژنتیکی اطمینان حاصل شود.
۲. ۲۰۰ میکرو لیتر کلروفرم به آن افزوده شد، آن را کاملاً در جهت بالا و پایین تکان می‌دهیم نموده تا دو فاز با یکدیگر مخلوط شود.
۳. ویال‌ها در دور g ۱۲۰۰۰ و به مدت ۱۵ دقیقه و در دمای ۴ درجه سانتی‌گراد سانتریفیوژ شد. در این حالت ۳ فاز ایجاد گردید که فاز رویی RNA، فاز میانی
شامل DNA و فاز زیرین پروتئین و چربی‌ها است. (شکل ۲-۵)

مطلب مشابه :  پایان نامه با کلید واژگاننظام مالی، آزادسازی مالی، نهادهای قانونی، توسعه مالی

شکل ۲- ۳: ۳ فاز تشکیل‌شده در استخراج RNA
۴. فاز رویی که شامل RNA است به ویال دیگری انتقال داده شد و هم‌ حجم آن ایزوپروپانول اضافه گردید و به مدت یک ساعت در فریزر -۲۰ درجه سانتی‌گراد انکوبه شد.
۵.. پس از انکوباسیون در دور g ۱۲۰۰۰ و به مدت ۱۰ دقیقه در دمای ۴ درجه سانتی‌گراد سانتریفیوژ شده. محلول رویی دور ریخته شد.
۶ رسوب RNA استخراج‌ شده با ۱ میلی‌لیتر اتانول ۷۰% که با اتانول خالص و آب دپس تهیه‌شده است، شستشو داده شد. سپس در دور g ۷۵۰۰ و به مدت ۵ دقیقه در دمای ۵ درجه سانتی‌گراد سانتریفیوژ شد. محلول رویی دور ریخته شد و به آن زمان داده تا الکل خشک شود.
۷. رسوب RNA استخراج‌شده در ۳۰ میلی‌لیتر آب دپس حل شد.
شکل (۲-۴) خلاصه‌ای از مراحل استخراج RNA را نشان می‌دهد.
*توجه شود که تمام مراحل بر روی یخ انجام‌شده و کلیه تجهیزات به‌کاررفته باید RNAse free باشد تا از تجزیه RNA جلوگیری کند.

شکل ۲- ۴: نمای کلی از استخراج RNA

۲-۷-۲ تیمار RNA با DNAaseІ
به‌منظور از میان بردن آلودگی DNA تیمار RNA توسط آنزیم DNaseІ صورت می‌گیرد.
در این روش ابتدا مواد زیر با یکدیگر مخلوط شد و سپس به مدت ۱۵ دقیقه در دمای ۳۷ درجه سانتی‌گراد انکوبه گردید:
RNase inhibitor(40U/μl) :5/0میکرولیتر
DNaseІ :یک پنجم میزان میکروگرم نمونه اضافه شده
بافر x 10 : یک دهم حجم نهایی
نمونه(حداقل ۱۵ میکروگرم RNA)

پس از اتمام انکوباسیون هم‌حجم آنزیم اضافه‌شده در مرحله قبل EDTA اضافه شد. سپس نمونه به مدت ۱۰ دقیقه در دمای ۶۵ درجه سانتی‌گراد انکوبه شد.
درواقع EDTA1 به دام انداز یون بوده و آنزیم را غیرفعال می‌کند.
۲-۷-۳ تعیین جذب نوری و غلظت نمونه‌های RNA
به‌منظور تعیین غلظت نمونه‌های RNA قبل و بعد از تیمار از دستگاه اسپکتوفتومتری استفاده شد. در این روش ۲ میکرو لیتر از RNA به همراه ۹۸ میکرو لیتر آب دیونیزه داخل کوت های مخصوص ریخته شد. کووت ها در دستگاه قرار گرفتند و غلظت و جذب نوری آن‌ها در طول ‌موج‌های ۲۸۰،۲۶۰ و ۲۳۰ و نیز نسبت جذب طول ‌موج‌های ۲۸۰ /۲۶۰ خوانده شد. این نسبت نشان‌دهنده میزان خلوص نمونه استخراج ‌شده است. RNA خالص جذب ۲۸۰ /۲۶۰ حدود ۲ است. مقادیر پایین‌تر از این جذب نشان‌دهنده آلودگی نمونه استخراج‌ شده به پروتئین است.

۲-۷-۴ الکتروفورز، رنگ‌آمیزی و مشاهده RNA بر روی ژل آگارز
الکتروفورز روشی است که بر اساس خواص فیزیکی مانند شکل فضایی، وزن مولکولی و بار الکتریکی، ماکرومولکولهای زیستی را تفکیک می‌کند. برای مشاهده نتیجه اینکه آیا RNA باکیفیت خوبی استخراج‌ شده از الکتروفورز استفاده می‌شود. در این شرایط ۲ باندی RNA شامل s18 و s28 بر روی ژل آگارز قابل‌رؤیت خواهد بود و چنانچه RNA آلوده به DNA باشد در بالاترین نقطه باند DNA نیز مشاهده می‌شود. (شکل ۲-۵)
برای انجام الکتروفورز ابتدا ژل اگارز ساخته شد. درصد ژل برای سنجش کیفیت RNA ۱% است. میزان پودر آگارز مورد نیاز ابتدا وزن شد و سپس در محلول تریس-استات-EDTA45 به کمک مایکروویو حل گردید.
سپس محلول در ظرف الکتروفورز مناسب که پیش‌تر شانه گذاری شده بود ریخته شد. پس از بستن ژل و جدا کردن شانه به تانک الکتروفورز انتقال داده شد. ۱ میکروگرم RNA را به همراه ۳ میکرو لیتر رنگ بارگذاری۴۶ x ۶ مخلوط و در چاهک‌ها ریخته شدند. برای تعیین اندازه، DNA Ladder با اندازه Kb1 نیز دریکی از چاهک‌ها ریخته شد.. در این مرحله الکتروفورز با ولتاژ ثابت ۸۰ ولت انجام گرفت. پس از اتمام الکتروفورز، برای رنگ‌آمیزی باندهای ایجادشده بارنگ فلورسنت، ژل به مدت ۱۵ دقیقه در محلول ug/ml ۵/۰ اتیدیوم برنمی‌آید و آب مقطر قرار داده شد و سپس باندها روی دستگاه مولد پرتو فرابنفش مشاهده شد.

شکل ۲- ۵: RNA استخراج‌شده بر روی ژل اگاروز

۲-۷-۵ سنتز cDNA
به‌منظور انجام PCR باید ابتدا از روی RNA، cDNA ساخته شود. برای سنتز CDNA به ازای هر نمونه ۲ ویال ۵/. میکرو لیتری نیاز است. ویال RT+ و ویال RT- (کنترل منفی). در ویال RT- آنزیم نسخه‌بردار معکوس۴۷ اضافه نشد تا آلودگی نمونه به DNA مشخص شود. مراحل انجام کار با استفاده از کیت سنتز cDNA شرکت فرمنتاز۴۸ انجام شد:
در هر ۲ ویال مثبت و منفی برای هر نمونه مواد زیر ریخته شد:
پرایمر هگزامر تصادفی۴۹: ۱ میکرو لیتر
نمونه: ۱ یا ۲ میکروگرم (حجم نمونه نباید بیشتر از ۸ میکرو لیتر باشد)
آب مقطر فاقد یون: تا حجم نهایی ۱۲ میکرو لیتر
سپس ویالها به مدت ۵ دقیقه در دمای ۶۵ درجه سانتی‌گراد انکوبه شده و بلافاصله روی یخ منتقل شدند. سپس به ویالها مواد زیر اضافه شد:
بافر واکنش (ҳ۵): ۴ میکرو لیتر
مخلوط دئوکسی نوکلئوتید تری فسفات۵۰: ۲ میکرو لیتر
مهارکننده ریبونوکلئاز۵۱: ۱ میکرو لیتر
آنزیم نسخه‌بردار معکوس۵۲: ۱ میکرو لیتر (آنزیم فقط به نمونه مثبت اضافه شد) نمونه‌ها ابتدا به مدت ۵ دقیقه در دمای ۳۰ درجه سانتی‌گراد (جهت اتصال پرایمر به نمونه) و سپس به مدت ۱ ساعت در دمای ۴۲ درجه سانتی‌گراد (دمای فعالیت آنزیم) انکوبه شدند. در آخر برای غیرفعال کردن آنزیم نمونه‌ها به مدت ۵ دقیقه در دمای ۷۰ درجه سانتی‌گراد قرار داده شدند.

مطلب مشابه :  دانلود پایان نامه درموردپرسش نامه، تشویق و تنبیه، پژوهش علمی، قابلیت اعتماد

۲-۷-۶ واکنش زنجیره‌ای پلیمراز ۵۳
به‌منظور بررسی بیان کیفی ژن‌ها از RT-PCR و به‌منظور بررسی بیان کمی ژن‌ها از Real time -PCR استفاده شد.

۲-۷-۷ پرایمر
پرایمر ها قطعات کوتاه نوکلوتیدی هستند که برای تکثیر قطعه‌ای خاصی از ژن هدف به کار می‌رود. برای تکثیر ژن ۲ پرای
مر مورد نیاز است که یکی از آن‌ها پرایمر مستقیم۵۴ و دیگری پرایمر معکوس۵۵ است. در واکنش زنجیره‌ای پلیمر از در دو طرف توالی هدف اتصال می‌یابند و امکان شروع فعالیت پلیمرازی آنزیم DNA پلیمراز را فراهم می‌آورند. بنابراین اولین خصوصیت پرایمر توالی صحیح آن‌ها جهت اتصال به مکان موردنظر برای تکثیر است. در جدول (۲-۵) توالی پرایمر های ژن‌هایی که در این مطالعه استفاده‌ شده‌اند، آورده شده است.

جدول ۲- ۵: توالی پرایمر
دمای ذوب پرایمر
Tm ( °C)
سکانس پرایمر
نام ژن
۵۷ °C
F:5´ AACTATCTCCTACTACTCTTTCCC3´
R: 5′ CACTCCTCTTCCTATATGCCT3´
rH-smad2
58 °C
F: 5´AGACACCAGTTCTACCTCCT3´
R: 5´ GGTCTCTGGAATATTGCTCTG3´
rH-smad3

۲-۷-۸ نحوه رقیق کردن پرایمر
تمامی پرایمرهای خریداری ‌شده به‌صورت لیوفیلیزه است. بنابراین باید به آن‌ها مقادیر مناسبی آب مقطر استریل اضافه نمود. این مقادیر در دستورالعملی که به همراه پرایمر ارسال گشته ذکرشده. درنتیجه در ابتدا با اضافه کردن مقادیر مناسبی از آب مقطر به هرکدام از پرایمرها مطابق دستورالعمل همراه غلظت آن به ۱۰۰ پیکو مول بر میکرو لیتر رسانده شد و حداقل به مدت ۸ ساعت در دمای ۴ درجه سانتی‌گراد قرار داده شد. در مرحله بعد این پرایمرها به غلظت ۵ پیکو مول بر میکرو لیتر رقیق شد.

۲-۷-۹ Real time PCR
Real time PCR روش تکامل‌ یافته‌ای از PCR است. در این سیستم تشخیصی در طی هر سیکل و متناسب با میزان محصول تولیدی در هر سیکل ماده‌ای فلورسانت آزاد می‌گردد که میزان فلورسانس آن توسط شناساگر۵۶، شناسایی و ثبت می‌گردد.
انجام Real time PCR با استفاده از سایبرگرین۵۷:
سایبرگرین جز رنگ‌های سیانین نامتقارن ۵۸است و از رنگ‌های متصل شونده به DNA است. در شکل (۲-۶) ساختار شیمیایی این رنگ نشان داده ‌شده است.

شکل ۲- ۶: ساختار شیمیایی سایبر گرین

این رنگ به شکاف کوچک مولکول DNA ۲ رشته متصل می‌گردد با افزایش مقدار DNA محصول ضمن PCR، سایبر گرین بیشتری به آن متصل شده و میزان فلورسانس افزایش خواهد یافت. میزان فلورسانس متناسب با مقدار مولکول‌های DNA ۲ رشته خواهد بود و میزان تکثیر را می‌توان طی زمان و از طریق اندازه‌گیری فلورسانس در هر چرخه اندازه بررسی نمود. شکل (۲-۷) مکانیسم عملکردی این رنگ را نشان می‌دهد. سایبرگرین هنگامی‌که به DNA ۲ رشته متصل باشد نور را در طول ‌موج ۴۸۰ نانومتر جذب کرده و در طول‌موج ۵۲۰ نانومتر منتشر می‌نماید.

شکل ۲- ۷: مکانیسم عمل سایبر گرین

مراحل انجام کار:
برای انجام Real time PCR مواد زیر بایکدیگر مخلوط شدند:
Power SYBER Green PCR master mix (2x) : ده میکرولیتر
پرایمر رشته Forward: یک میکرولیتر
پرایمر رشته Revesrse: یک میکرولیتر
آب دیونیزه: شش میکرولیتر
نمونه cDNA 25 نانوگرمی: دو میکرو لیتر
علاوه بر نمونه های اصلی دو کنترل منفی RT- و NTC نیز به ترتیب برای بررسی آلودگی نمونه cDNA و آلودگی مواد به DNA تهیه شدند. به ازای هر جفت پرایمر مورد استفاده، یک نمونه NTC تهیه شد.
برنامه Real time PCR به شرح زیر بوده:
۱۰٫۱ دقیقه در ۹۵ درجه سانتیگراد(فعال سازی انزیم و واسرشت سازی اولیه)
۱۵٫۲ ثانیه در دمای ۹۵ درجه سانتیگراد (زمان واسرشت سازی هر چرخه)
۱٫۳ دقیقه در دمای ۶۲ درجه سانتیگراد (دمای اتصال و طویل سازی هر چرخه