منبع پایان نامه ارشد درمورد تلومر، تلومراز، الکتروشیمیایی، سیترات

دسامبر 29, 2018 0 By mitra1--javid

است، از آنجا که گروههای فسفات موجود در پیکره DNA بار منفی را به این ساختار القا میکنند، در نتیجه مولکول DNAتمایل زیادی به برهمکنش با یونها و مولکولهای مثبت موجود در محیط دارد. بنابراین، برهمکنش الکترواستاتیک بین مولکول DNAو یونهای مثبت موجود در محیط ایجاد میشود که البته این اتصال، نوعی اتصال خارجی غیر اختصاصی است [113].
2-8-2- برهمکنش درون رشتهای58:
این نوع برهمکنش، در واقع با سطح بازهای DNA اتفاق میافتد و اغلب به ساختارهای حلقوی مسطح مربوط است که قادرند در بین صفحات بازهای DNA قرار گیرند و اغلب، این نوع مولکولها، خصوصیات دائمی دارند.
2-8-3- برهمکنش با شیارها:
در واقع پیچ خوردن مولکول DNAبه دور خود، باعث ایجاد دو نوع شیار بزرگ و کوچک در ساختارDNA میشود. در واقع مولکولها یا لیگاندهایی که هم اندازه، این شیارها باشند. قادرند در این شیارها جای گیرند و با DNA برهم کنش دهند. این نوع برهمکنشها بسته به نوع مولکول DNA مورد نظر و بازهای موجود در ساختار DNAمتفاوت خواهد بود. در توالیهای غنی از آدنین- تیمین59 شیار کوچک فعالتر است، در حالیکه در توالیهای غنی از گوانین- سیتوزین60 شیار بزرگتر فعالتر است [114].
2-9- تلومر:
تلومر كه در سال 1938، براي اولين بار، توسط مولر61 شناسايي شد، ساختار انتهايي كروموزوم در سلولهای يوكاريوت است كه وظيفه حياتي حفاظت از انتهاي كروموزوم را بر عهده دارد. هر تلومر از توالی کوتاهی تشکیل میشود که به تعداد زیاد و پشت سر هم تکرار شدهاند. وجود تلومر موجب سركوب ژنهاي مجاور ميشود و كوتاه شدن تلومر موجب كاهش قلمرو اثر آن در سركوب ژنهاي مجاور ميگردد و ژنهايي كه تاكنون خاموش بودهاند، روشن ميشوند. هر زمان که یک سلول تقسیم میشود، قسمتی از تلومر خود را از دست می دهد (در حدود 25 تا200 جفت باز در هر تقسیم). زمانی که تلومر بسیار کوچک شود و به طول بحرانی62 خود برسد دیگر نمیتواند همانند سازی کند. عمل تلومر در راستای جلوگیری از دست دادن توالیهای بازی در انتهای کرموزومها، میباشد و همچنین از چسبیدن کروموزومها به یکدیگر جلوگیری میکند [115].
2-10- آنزیم تلومراز:
تلومراز آنزيمي است كه توالي تلومري (TTAGGG) را در انتهاي كروموزومها در انسان سنتز مي‌كند. در خلال تكثير سلولي، كرموزومها، به طور پيوسته از انتهاي تلومر در حال كوتاه شدن هستند كه اين كوتاه شدن درازاي تلومر، در نهايت به توقف تكثير سلولي منجر ميشود. در بیشتر سلولهای طبیعی انسانی، غیر از لنفوسیتها و سلولهای بنیادی، فعالیت تلومر بعد از تولد کاهش مییابد و طول تلومر با هر تقسیم سلولی کوتاه میشود [116]. در سلولهای طبیعی به دلیل فعال نبودن این آنزیم، پس از هر یک از تقسیمات متوالی، درازای تلومر کاهش مییابد تا به حد آستانهای از کوتاه شدن میرسد که در این حالت تلومر کوتاه شده، مانند سدی در برابر تقسیمات سلولی، عمل میکند و مانع انجام تقسیمات بیشتر میگردد [117]، اما در سلولهای سرطانی که آنزیم تلومراز فعال است، ادامه تقسیمهای متوالی به دلیل بیان بالای آنزیم تلومراز ممکن میشود و سلول به سمت نامیرایی و تومورزایی پیش میرود. حدود 90 درصد از سلول هاي سرطاني، داراي سطح بالايي از آنزيم تلومراز هستند. اين سلولها به كمك آنزيم تلومراز، كوتاه شدن تلومر را كه در پي تقسيمهاي متوالي روي ميدهد، جبران ميكنند. در مجموع تلومراز ميتواند يك هدف مناسب در درمان و مهار سرطان به حساب آيد. تاكنون روشهاي گوناگوني، مانند: مهار مستقيم تلومراز و ايمني درماني تلومراز برا ي مهار این آنزيم پيشنهاد شده است [118]. از این رو در این پایان نامه سعی می‌شود که اثرات داروی تاموکسیفن سیترات به عنوان لیگاند برای پایداری ساختار i-motif DNA به روش‌های مختلف الکتروشیمیایی و طیفبینی مورد مطالعه قرار گیرد.

3-1- مواد شیمیایی
مشخصات مواد شیمیایی مورد استفاده در این کار تحقیقاتی، در جدول 3-1 ارائه شد.
جدول3-1- مواد شیمیایی مورد استفاده
ردیف
نام ترکیب شیمیایی
درصدخلوص
نام شرکت
1
DNA کاوشگر

فزا بیوتک63، آلمان
2
DNA های مکمل

فزا بیوتک، آلمان
3
نانوذره 2SiO
999
توکیو، ژاپن
۴
منیزیم کلراید
5/999
فلوکا64، سوئیس
۵
سدیم کلرید
100-5/99
صنایع شیمیایی و داروئی ارسطو
8
سدیم دی هیدروژن فسفات
99
مرک65، آلمان
۹
دی سدیم هیدروژن فسفات
98
مرک، آلمان
۱۰
سدیم استات
5/999
فلوکا، سوئیس
۱۱
تاموکسیفن سیترات

داروسازی ایران- هورمون
۱۲
پتاسیم هگزا سیانوفرات
999
فلوکا، سوئیس
۱۳
پتاسیم هگزا سیانوفریت
999
مرک، آلمان
14
پودر گرافیت
مش ذرات mm1/0
فلوکا، سوئیس
15
روغن پارافین
چگالیg cm-3 88/0
فلوکا، سوئیس
16
سدیم هیدروکسید
خلوص 99%
مرک، آلمان
17
استیک اسید
5/999
فلوکا، سوئیس
18
L- سیستئین
خلوص 97%
سیگما -آلدریچ

توالی های DNA های مورد استفاده به شرح ذیل می باشد:

DNA برای تشکیل ساختار i-motif :
5′ – CCCTAACCCTAACCCTAACCC – 3′
توالی DNA ی مکمل:
5′ – GGGTTAGGGTTAGGGTTAGGG – 3′

(الف) ساختار داروی ضد سرطان تاموکسیفن سیترات و (ب) اسید آمینه L- سیستئین در شکل 3-1 ارائه شده است.
الف

ب

شکل 3-1-الف) فرمول ساختاری و برخی از ویژگیهای تاموکسیفن سیترات [42]
و ب) ساختار L- سیستئین.

3-2- وسایل و تجهیزات
فهرست تجهیزات مورد استفاده جهت انجام کارهای آزمایشگاهی به شرح زیر می باشد:
جهت انجام آزمايشهای الكتروشيميايي از دستگاه پتانسيواستات-گالوانواستات اتولب66 مدل 30 ساخت كشور هلند استفاده شد. اين دستگاه مجهز به ماژول الكترونيكي مورد نياز براي روبش و اعمال فركانس در بازه‏اي وسيع از حدود 1 مگاهرتز تا یک میلی هرتز و همچنین برد FRA2، ميباشد. این دستگاه جهت انجام مطالعات ولتامتري و طیفبینی امپدانس الکتروشیمیایی، توسط نرمافزارهاي به ترتيبGPES 4.9 و FRA كنترل میشود.
1- دستگاه پتانسیواستات / گالوانو ستات مدل:
Autolab, PGSTAT30, Eco Chemi, Netherlands شکل (3-2 الف).
2- کامپیوتر پنتیوم (VI).
3- سل آزمایشگاهی نوع Universal titration vessa. Metrohm Switzerland به عنوان ظرف آزمایش به کار رفته است (شکل3-2 ب).
4- دستگاه pHمتر ساخت کشور انگلستان: Ion Analyzer Corning
5- سل مخصوص DNA، ساخت شرکت آذر الکترود- ایران
6- ویال جهت آماده سازی نمونهها
7- میکرو پیپت جهت برداشتن مقادیر بسیار کم از محلول

شکل ۳-2- (الف) دستگاه پتانسیواستات / گالوانواستات اتولب67 و (ب) سل آزمایشگاهی.

3-3- الکترودهای مورد استفاده :
به منظور حذف اثرات افت اهمی، از سیستم سه الکترودی زیراستفاده شد:
الکترود کار68 : از الکترودهای خمیر کربن برهنه و خمیر کربن اصلاح شده با نانوذرات سیلیس به عنوان الکتروهای کار استفاده شد.
الکترود کمکی69 : از یک سیم پلاتین به عنوان الکترود مخالف یا کمکی برای انجام روشهای مختلف الکتروشیمیایی استفاده شد.
الکترود شاهد70 : از یک الکترود نقره/ کلرید نقره/ پتاسیم کلرید (M 3)، به عنوان الکترود شاهد استفاده شد.
3-4-تهیه الکترودهای کار:
الکترودهای کار مورد استفاده در این پژوهش، با روشهای زیر تهیه شدند:
3-4-1- تهیهی الکترود خمیر کربن برهنه (CPE)
مخلوط پودر گرافیت و روغن پارافین در یک هاون دستی بهم زده میشود تا مخلوط خمیری کاملا همگن تهیه شود. خمیر تهیه شده به انتهای باز و صاف یک لوله شیشهای به قطر داخلی mm 4/6 وارد نموده و با سایش سطح الکترود بر روی یک کاغذ تمیز، سطح کاملاً صاف و یکنواختی بدست میآید برای اتصال الکتریکی الکترود، یک سیم مسی به کار میرود که از یک طرف وارد لوله شیشهای شده و با خمیر کربن در اتصال است و از طرف دیگر توسط یک فیش به دستگاه الکتروشیمیایی متصل میگردد. از انتهای دیگر لوله
ی شیشهای یک سیم مسی به خمیر کربن متصل میشود. با هل دادن سیم مسی به طرف پائین، لایهای از خمیر کربن از انتهای دیگر لوله شیشهای خارج میگردد.
3-4-2- تهیه الکترود خمیر کربن اصلاح شده با نانوذرات 2 SiO و –L سیستئین L -Cys) /2NSiO):
کربن اصلاح شده با مخلوط کردن پودر گرافیت، اسید آمینه L- سیستئین و محلول کلوئیدی نانوذرات 2SiO قبل از افزودن روغن پارافین تهیه شد سپس با اختلاط کربن اصلاح شده با روغن پارافین به (نسبت وزنی 70:30)، خمیر کربن اصلاح شده تهیه گردید. بخشی از خمیر کربن اصلاح شده در ته لوله شیشهای با قطر داخلی ( mm5) قرار داده شد تا الکترود خمیر کربن اصلاح شده مطابق روش ذکر شده قبلی تهیه شود. سطح الکترود خمیر کربن را روی کاغذ پولیش داده تا سطح صاف ایجاد شود. پس از هر بار آزمایش، یک سطح جدید میتواند با فشردن سیم مسی اتصال دهنده الکتریکی، ایجاد شود و بدین ترتیب سطح الکترود خمیر کربن اصلاح شده هر بار تجدید میگردد. الکترود کار قبل از استفاده، با آب مقطر یون زدایی شده شسته میشود. مراحل تهیه الکترود اصلاح شده به صورت نموداری در شکل 5-1، ارائه شده است.

شکل3- 3- نمایش نموداری از تهیه الکترود خمیر کربن اصلاح شده.

3-5- بافرهای مورد استفاده برای تثبیت pH
از محلولهای بافر فسفات با غلظت کل M1/0 که دارای سدیم کلرید M1/0 به عنوان الکترولیت حامل بودند، برای تثبیت pH محلولهای آزمایشی در محدودهی pH، 5/4 تا 0/7 استفاده شد. از محلولهای بافری زیر، جهت تنظیم و تثبیت pH، محلولهای آزمایشی مورد نیاز، استفاده گردید:
– برای محدوده 00/4 ≥pH ≥ 00/2; از محلول مخلوط ارتو فسفریک اسید و سدیم دی هیدروژن فسفات به غلظت کلی M1/0
– برای محدوده 00/9 ≥pH ≥00/5; از محلول دارای سدیم دی هیدروژن فسفات و دی سدیم هیدروژن فسفات به غلظت کلی M1/0
غلظت کلی بافرهای فسفات ثابت بوده و غلظت هر یک از اجزای تشکیل دهنده آن از رابطهی زیر بدست میآید.
pH = pKa + log ([اسید] / [باز]) معادله (3-1)
pH محلول بافر تهیه شده توسط دستگاه pH متر بطور تجربی اندازهگیری شد. در صورتی که pH اندازه
گیری شده محلول بافر، اندکی با pH مورد نظر تفاوت داشت، با اضافه کردن محلول غلیظ سدیم هیدروکسید یا فسفریک اسید به محلول بافر، pH آن در مقدار مورد نظر تنظیم شد. همچنین مطابق معادله (3-1)، محلول بافر استات M 5/0 حاویM NaCl 1/0، در 8/4pH= تهیه شد.

3-6- تهیه محلولها
برای تهیه محلول مادر الیگونوکلئوتیدها ( M۴-10)، از محلول بافر فسفات 71PBS))، (فسفات mM 100، 2 mM MgCl0/1 ، M NaCl5/1 ،5/4 PH=) استفاده شد. این محلول در فریزر نگهداری شد. محلولهای پتاسیم هگزاسیانوفرات و پتاسیم هگزاسیانوفریت با غلظتM 01/0 بایستی تازه تهیه شود و در یخچال نگهداری گردد. همچنین محلول بافر استات M 5/0 (8/4pH=) حاویM NaCl 1/0 که به عنوان محلول فعالسازی بوده و به منظور پیشتیمار الکتروشیمیایی الکترودهای کار استفاده میشد، بایستی روزانه تازه تهیه میشود. محلول داروی تاموکسیفن سیترات به غلظت M3-10 به عنوان محلول استوک در آب و متانول ب
ه نسبت (v/v 15/85) آماده سازی شد و غلظتهای مختلف دارو از محلول استوک تهیه شد. به منظور تهیه محلول DNA دورشتهای، حجمهای یکسانی از غلظتهای مساوی جفت الیگونوکلئوتیدهای مکمل را درون یک ویال مخلوط کرده و سپس محلول مخلوط شده در دمای С°۹۰، درون حمام بخار به مدت ۶ دقیقه گرما داده میشود و سپس به آن اجازه میدهیم که به آرامی خنک شود و به دمای محیط برسد [119].

3- 7- مشخصهیابی سطح الکترود
برای مطالعه سطح الکترودهای اصلاح شده از روش تصویر برداری میکروسکوپی الکترون روبشی 72 (SEM) استفاده میگردد.
SEM، یکی از مهمترین و پرکاربردترین فنون مشخصهیابی ساختارهای نانو است که برای بررسی ساختار سطحی و اندازهی مواد نانو بکار میرود. تکنیک SEM میتواند با بمباران الکترونی، از سطح اجسامی به کوچکی 10 نانومتر، تصویر برداری کند. در حین بمباران، الکترونهایی به سمت صفحهی دارای بار مثبت رها میشوند که سبب ایجاد علامت میگردند. حرکت پرتو بر روی نمونههای آزمایشی، مجموعهای از علائم را فراهم میکند که بر این اساس، میکروسکوپ میتواند تصویری از سطح را بر صفحهی کامپیوتر نمایش دهد. همچنین، معمولاً باید سطح نمونههایی که با SEM بررسی میشوند با یک مادهی هادی الکتریسیته پوشانده شود. در غیر این صورت، الکترونی که به سطح نمونه تابیده میشود، دفع نشده، روی سطح باقی مانده و بار ساکن ایجاد میکند. الکترونهای بعدی با این بار ساکن دارای بار همنام، برخورد نموده، دفع یا منحرف می
شوند و در نتیجه تصویر حاصله ناپایدار شده و وضوح آن کاهش مییابد. از اینرو، معمولاً با نشاندن لایهی نازکی از طلا و پلاتین، سطح نمونههای غیر هادی، هدایت الکترونی پیدا میکنند و الکترونهای سطحی دفع شده و مشکل فوق برطرف گردیده و وضوح تصویر نیز بهبود مییابد.

4-1- مطالعه ولتامتری چرخهای الکترودهای کار
روش ولتامتری چرخهای، به عنوان یک روش ساده برای بررسی رفتار الکتروشیمیایی محلول دارای -4/-3 [6(CN)[Fe در سطح الکترود خمیر کربن برهنه (CPE) و اصلاح شده با /CPE2NSiO بکار رفته است که در این راستا، ولتاموگرامهای چرخهای در محدوده پتانسیلی 5/0- تا V 8/0 نسبت به الکترود شاهد Ag|AgCl|KCl (3M) با سرعت روبش mV s-1 ۵0 رسم شده است (شکل 4-1).

شکل4-1- ولتاموگرامهای چرخهای محلول -4/-3[6(CN)[Fe M 01/0 دارای NaCl M 1/0 در سطح (a) CPE و(b) /CPE2NSiO در سرعت روبش 1-s mV 50 .

بطوریکه ملاحظه میشود، جریان دماغههای آندی و کاتدی زوج اکسنده/کاهنده فرو/ فری سیانور در سطح الکترود خمیر کربن با نانو ذرات 2 SiOبه مقدار قابل ملاحظهای بیشتر از سطح الکترود خمیر کربن تنها
میباشد. همچنین میزان جدایی پتانسیل دماغههای آندی و کاتدی ∆EP (∆Ep = Epa – Epc) در سطح الکترود خمیر کربن اصلاح شده کمتر از الکترود خمیر کربن برهنه است. علت این امر را حضور نانو ذرات 2 SiOدر سطح الکترود خمیر کربن اصلاح شده نسبت میدهند که با افزایش نسبت سطح به حجم و در نتیجه افزایش سطح مؤثر در سطح الکترود خمیر کربن اصلاح شده با نانو ذرات